View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19404_low_7 (Length: 309)
Name: NF19404_low_7
Description: NF19404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19404_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 414260 - 414546
Alignment:
| Q |
18 |
ataattatcccataaataaatgctctcaattcgtttcattacatcattctctcatttcgatttcaaatctcactttcttctcttttct------tccgcc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
414260 |
ataattatcccataaataaatgctctcaattcgtttcattacatcattctctcatttcaatttcaaatctcactttcttctcttttcttcttcttccgcc |
414359 |
T |
 |
| Q |
112 |
gcaaccatgtcatccaccaccgcaaccaacgccgtctccgccacagatgatgcgaaacacggtttctctcgtcctgagatgtacaaagaaaacctcgctg |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414360 |
gcaaccatgtcatccaccaccgcaaccgacgccgtctccgccacagatgatgcgaaacacggtttctctcgtcctgagatgtacaaagaaaacctcgctg |
414459 |
T |
 |
| Q |
212 |
gaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcctccgcgtcttgaagcttctgatgatg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
414460 |
gaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcctccgcgtcttgaagcttctgatgatg |
414546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 173 - 296
Target Start/End: Complemental strand, 401202 - 401079
Alignment:
| Q |
173 |
gtttctctcgtcctgagatgtacaaagaaaacctcgctggaaccgtagcttcttacgatcgtcacgtttttctctgttacaagaatcgtcaaacttggcc |
272 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||| |||||||| || | || ||||||||||| || ||||| ||||||||||| | ||||||||||| |
|
|
| T |
401202 |
gtttctcccgttatgagatgtacaagcaaaaccttgctggaacagttgaatcctacgatcgtcatgtctttctatgttacaagaaccaccaaacttggcc |
401103 |
T |
 |
| Q |
273 |
tccgcgtcttgaagcttctgatga |
296 |
Q |
| |
|
|||| || ||||||| || ||||| |
|
|
| T |
401102 |
tccgtgtgttgaagcctccgatga |
401079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University