View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19404_low_9 (Length: 235)
Name: NF19404_low_9
Description: NF19404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19404_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 227
Target Start/End: Original strand, 42088709 - 42088923
Alignment:
| Q |
16 |
attactggtagaagatatgatgttcataatattaaatatatctgccaata---ttaattattcaattgaacatttttatatcaactcaaatttggaactt |
112 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42088709 |
attactgatagaagatatgatgttcataatattaaatatatctgccaatagtattaattattcaattgaacatttttatatgaactcaaatttggaactt |
42088808 |
T |
 |
| Q |
113 |
cacaattcacatttgtgtgtgagaattttagtgtccttgttaatttttgtttttgtatagtttagttgataaaaaattcatcttttttatcaagcatatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42088809 |
cacaattcacatttgtgtgtgagaattttagtgtacttgttaatttttgtttttgtatagtttagttgataaaaaattcatcttttttatcaaacatatc |
42088908 |
T |
 |
| Q |
213 |
ctaatcgagtattat |
227 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42088909 |
ctaatcgagtattat |
42088923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University