View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19405_high_16 (Length: 297)
Name: NF19405_high_16
Description: NF19405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19405_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 14 - 277
Target Start/End: Complemental strand, 50763134 - 50762883
Alignment:
| Q |
14 |
agataataaccaatcactggctagagggtaatgatttgcgttacaggtttaaaaagctatttgacttagcgaatgacaagtttctgacagtggctgggat |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50763134 |
agataataaccaatcactgactagagggtaatgatttgcgttacaggtttaaaaagctatttgacttagcgaatgacaagtt-------------gggat |
50763048 |
T |
 |
| Q |
114 |
gtgtactttaaggtgagtgggatgtaggagaagatgggtggaagtagctaagatgtgtacttttaaggttgaggagt---gtagtctcttgttgtttaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50763047 |
gtgtactttaaggtgagtgggatgtaggagaagatgggtggaagtagctaagatgtgtac-tttaaggttgaggagtgtagtagtctcttgttgtttaac |
50762949 |
T |
 |
| Q |
211 |
nnnnnnnatatattggtgtgcatgacaaatggaaatggaagttatattcggacaaaggatactcaat |
277 |
Q |
| |
|
| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50762948 |
tttttttacatattggtgtgcat-acaaatggaaatggaagttatattcggacaaaggatactcaat |
50762883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University