View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19405_high_20 (Length: 253)
Name: NF19405_high_20
Description: NF19405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19405_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 17782413 - 17782187
Alignment:
| Q |
9 |
gagaagcaaagggtatcgtggtaaatacgttacaagagcttgaaccctacgctcttcaatcactttatgatgattcacaacttccaccggtttacacaat |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
17782413 |
gagaaacaaagggtatcgtggtaaatacgttacaagagcttgaaccctacgctcttcaatcactttatgatgattcgcagcttccaccggtttacacaat |
17782314 |
T |
 |
| Q |
109 |
tgggccggttattgatcttgttggaccggctgaatgggatccaaacccagtccaatataattatataatgcagtggctcgatttgcagcctcttgcttct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17782313 |
tgggccggttattgatcttgttggaccggctgaatgggatccaaacccagtccaatataattatataatggagtggctcgatttgcagcctcttgcttct |
17782214 |
T |
 |
| Q |
209 |
gtggnnnnnnnatgttttggtagtttg |
235 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
17782213 |
gtggtttttttatgttttggtagtttg |
17782187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 20582758 - 20582571
Alignment:
| Q |
9 |
gagaagcaaagggtatcgtggtaaatacgttacaagagcttgaaccctacgctcttcaatcactttatgatgattcacaacttccaccggtttacacaat |
108 |
Q |
| |
|
||||| |||||||||| ||||||||||| ||||||||||||||||| || ||||| ||||||||||| | |||| || |||||||| |||||| |||| |
|
|
| T |
20582758 |
gagaaacaaagggtattgtggtaaatacattacaagagcttgaaccttatgctctacaatcactttacaaggatttgcagcttccacctgtttacccaat |
20582659 |
T |
 |
| Q |
109 |
tgggccggttattgatcttgttggaccggctgaatgggatccaaacccagtccaatataattatataatgcagtggctcgatttgcag |
196 |
Q |
| |
|
||| |||||| | || ||||||||||||| ||||||| |||||||||||||| ||||||||||| ||| ||||| | ||||||||| |
|
|
| T |
20582658 |
tggaccggttctcgaccttgttggaccggtccaatgggacccaaacccagtccagtataattatatcatggagtggttagatttgcag |
20582571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 10 - 199
Target Start/End: Complemental strand, 20563594 - 20563405
Alignment:
| Q |
10 |
agaagcaaagggtatcgtggtaaatacgttacaagagcttgaaccctacgctcttcaatcactttatgatgattcacaacttccaccggtttacacaatt |
109 |
Q |
| |
|
|||| |||||||||| | |||||||| ||| ||||||||||||| ||||||||| |||||||| | |||||| || |||||||| |||||| ||||| |
|
|
| T |
20563594 |
agaaacaaagggtattatcgtaaatacattaaaagagcttgaaccatacgctcttgaatcacttcacaatgatttgcagcttccacctgtttacccaatt |
20563495 |
T |
 |
| Q |
110 |
gggccggttattgatcttgttggaccggctgaatgggatccaaacccagtccaatataattatataatgcagtggctcgatttgcagcct |
199 |
Q |
| |
|
|| |||||| |||||||||||||||||| |||||||||||||||| || || |||||||| || || ||||||| |||||||||||| |
|
|
| T |
20563494 |
ggaccggttcttgatcttgttggaccggtccaatgggatccaaacccggtacagtataattacatcgtggagtggcttgatttgcagcct |
20563405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University