View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19405_high_9 (Length: 368)
Name: NF19405_high_9
Description: NF19405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19405_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 117 - 214
Target Start/End: Complemental strand, 35645139 - 35645044
Alignment:
| Q |
117 |
ggagtgacaatgttgaaaaaattaatttttatgttatttaagaaatgatgtttcaatatatcaaatatctatatgtggttaaagaataaattttaagt |
214 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
35645139 |
ggagtgacaatgttgaaaaaattattttttatgttatttaagaaatgatgtttcaatatatcaaatatctata--tggttaaagaacaaattttaagt |
35645044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 266 - 353
Target Start/End: Complemental strand, 35645023 - 35644936
Alignment:
| Q |
266 |
ggatgtggcgttgttactttctgaaccttttcaacgagaaatcttttttgtgtaaaaacaaaataaatcattcaaggtttgaacaatt |
353 |
Q |
| |
|
|||||| | |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35645023 |
ggatgttgtgttgttactttctgaacctttttaacgagaaaacttttttgtgtaaaaacaaaataaatcattcaaggtttcaacaatt |
35644936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 12 - 78
Target Start/End: Complemental strand, 35645268 - 35645202
Alignment:
| Q |
12 |
atgaatgagaaaaattctccaatccatatcttgaaggaaaataaacaaatttatgcataattatcaa |
78 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35645268 |
atgaatgagagaaattctccaatccatatcttgaaggaaaataaacaaatttatgcatagttatcaa |
35645202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 272 - 340
Target Start/End: Original strand, 16554383 - 16554451
Alignment:
| Q |
272 |
ggcgttgttactttctgaaccttttcaacgagaaatcttttttgtgtaaaaacaaaataaatcattcaa |
340 |
Q |
| |
|
|||| |||||||||||||| |||||||||| ||| ||| |||||| ||||| |||||||||||||||| |
|
|
| T |
16554383 |
ggcgatgttactttctgaagattttcaacgaaaaaacttgtttgtgcaaaaataaaataaatcattcaa |
16554451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University