View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19405_low_19 (Length: 269)
Name: NF19405_low_19
Description: NF19405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19405_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 30173908 - 30173673
Alignment:
| Q |
16 |
aatatcttgtaaaagaacaagtgaatcatgtaaatatttatatacctgatggaatctcggatgaacttttccatttagatttgcaaattgcggaattgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
30173908 |
aatatcttgtaaaagaacaagtgaatcatgtaaatatgtatatacctgatggaatctcggatgaactcttccatttagatttgcaaattgcggaattgaa |
30173809 |
T |
|
| Q |
116 |
gccaagattcactaatcgatcgcatatttctgtaagcaaacatttccggcagctcaccaccggttgccggcacaagcatagcatctcagacatgttcaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
30173808 |
gccaagattcactaatcgatcgcatatttctgtaagcaaacatttccggcagctcaccaccggttgccggcacaagcatagcatctcagacatgtttatt |
30173709 |
T |
|
| Q |
216 |
tctctcatagcctcctttatagcttgcctaaccttt |
251 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30173708 |
tctctcatagcctcctttgtagcttgcctaaccttt |
30173673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 23 - 157
Target Start/End: Complemental strand, 12360133 - 12359999
Alignment:
| Q |
23 |
tgtaaaagaacaagtgaatcatgtaaatatttatatacctgatggaatctcggatgaacttttc-catttagatttgcaaattgcggaattgaagccaag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| ||||| ||||||| | |
|
|
| T |
12360133 |
tgtaaaagaacaagtgaatcatgtaaatatgtatatacctgatggaatctcggatgaactaccctaatttagatttgcaaattccggaaatgaagcc-ac |
12360035 |
T |
|
| Q |
122 |
attcactaatcgatcgcatatttctgtaagcaaaca |
157 |
Q |
| |
|
||||| ||| |||| ||||||||| | |||||||| |
|
|
| T |
12360034 |
attcaacaattgatcacatatttctctgagcaaaca |
12359999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University