View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19405_low_3 (Length: 414)
Name: NF19405_low_3
Description: NF19405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19405_low_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 18 - 414
Target Start/End: Original strand, 33157917 - 33158313
Alignment:
| Q |
18 |
atacgaagtcaaaagtagaagatcacaatgctcatcatcttcacaaggatgacttgatcggtgttggttcgaccacaaggatgatttgatcgatgttggt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33157917 |
atacgaagtcaaaagtagaagatcacaatgctcatcatcttcacaaggatgacctgatcggtgttggttcgaccacaaggatgacttgatcgatgttggt |
33158016 |
T |
 |
| Q |
118 |
ttgactaaaacaaagaaaacaaatattatttgagttttaaaacactcatatttggttctgattgtttttgtcgaaccgacatcactcacgaagttgtgag |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33158017 |
ttgactaaaacaaagaaaataaatattatttgagttttaaagcactcatatttggttctgattgtttttgtcgaaccgacatcactcacgaagttgtgag |
33158116 |
T |
 |
| Q |
218 |
gacgaagaggacagtaaacttctatttttagaaggtgacatagatcaccattgcaattttttgctttgagtggatcaaagtgttccgccgcagaagtagc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33158117 |
gacgaagaggacagtaaacttctatttttagaaggtgacatagatcaccattgcaattttttgctttgagtggatcaaagtgttccgccgcagaagtagc |
33158216 |
T |
 |
| Q |
318 |
ttcaatagaatatgttattggcatgctaatgcttgttgtctcctcttagagaaccatatttaagttagataaataaaagctagttgcagtccatatt |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33158217 |
ttcaatagaatatgttattggcatgctaatgcttgttgtctcctcttggagaaccatatttaagttagataaataaaagctagttgcagtccatatt |
33158313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University