View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19406_high_24 (Length: 279)
Name: NF19406_high_24
Description: NF19406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19406_high_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 158 - 271
Target Start/End: Original strand, 20363841 - 20363951
Alignment:
| Q |
158 |
gtgtggatatcgaaggatgataatgtttatgaaagaggagagcttggttgcgactgtatggtgttatgttgcatgtttggaatattcactttcttaattt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20363841 |
gtgtggatatcgaaggatgataatgtttatgaaagaggag--cttggttacgactgtatg-tattatgttgcatgtttggaatattcactttcttaattt |
20363937 |
T |
 |
| Q |
258 |
attttcttcgacat |
271 |
Q |
| |
|
|||||||||||| |
|
|
| T |
20363938 |
gatttcttcgacat |
20363951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 20371070 - 20371152
Alignment:
| Q |
1 |
gaaacatttggttgagggagaaaaatttcattgaaagagtgagaaaaaataaataagaacgagggagaaatgttgagcacttt |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20371070 |
gaaacatttggttgagggagaaaaatttcattgaaagagtgaggaaaaaaaaataagaacgagggagaaatgttgagcacttt |
20371152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 210 - 271
Target Start/End: Original strand, 20371625 - 20371686
Alignment:
| Q |
210 |
actgtatggtgttatgttgcatgtttggaatattcactttcttaatttattttcttcgacat |
271 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20371625 |
actgtatggtgttctgttgcatgtttggaatattcactttcttaatttgatttcttcgacat |
20371686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 101 - 144
Target Start/End: Original strand, 20371182 - 20371225
Alignment:
| Q |
101 |
gtcatgcacgaaggctataactagagaaggttaagaataattct |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20371182 |
gtcatgcacgaaggctataactagagaaggttaagaataattct |
20371225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University