View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19406_high_28 (Length: 264)
Name: NF19406_high_28
Description: NF19406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19406_high_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 22015376 - 22015137
Alignment:
| Q |
19 |
tacatctcttgatacaggtgttccctggattatgtgccagcaggctaatgcacctgatccaattgtatgttttttccttttagctatccacatagtttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22015376 |
tacatctcttgatacaggtgttccctggattatgtgccagcaggctaatgcacctgatccaattgtatgttttttccttttagctatccacatagtttta |
22015277 |
T |
|
| Q |
119 |
ttcagttaatgtttttctggattatcatctttcnnnnnnnagtaaaaggcaaaagaatagttcgatctgtgcttatcagacggtttcgttttactggatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22015276 |
ttcagttaatgtttttctggattatcatctttctttttttagtaaaaggcaaaagaatagttcgatctgtgcttatcagacggtttcgttttactggatt |
22015177 |
T |
|
| Q |
219 |
atttatcttcatgatagagctatcttaccatgatgatgtc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22015176 |
gtttatcttcatgatagagctatcttaccatgttgatgtc |
22015137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 203
Target Start/End: Original strand, 49588209 - 49588253
Alignment:
| Q |
159 |
agtaaaaggcaaaagaatagttcgatctgtgcttatcagacggtt |
203 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||||||| |||||| |
|
|
| T |
49588209 |
agtaaaaggcgaaagaatagttcgctttgtgcttatcacacggtt |
49588253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 40086122 - 40086194
Alignment:
| Q |
19 |
tacatctcttgatacaggtgttccctggattatgtgccagcaggctaatgcacctgatccaattgtatgtttt |
91 |
Q |
| |
|
||||||||||||||||||||| || ||| | ||||| ||||| || |||| ||||||||||||||| ||||| |
|
|
| T |
40086122 |
tacatctcttgatacaggtgtaccttgggtcatgtgtcagcaagcagatgctcctgatccaattgtaagtttt |
40086194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 5900574 - 5900530
Alignment:
| Q |
159 |
agtaaaaggcaaaagaatagttcgatctgtgcttatcagacggtt |
203 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||||||| |||||| |
|
|
| T |
5900574 |
agtaaaaggcgaaagaatagttcgctttgtgcttatcacacggtt |
5900530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 91
Target Start/End: Original strand, 40078326 - 40078398
Alignment:
| Q |
19 |
tacatctcttgatacaggtgttccctggattatgtgccagcaggctaatgcacctgatccaattgtatgtttt |
91 |
Q |
| |
|
|||||||||||||||||||||||| ||| | ||||| ||||| | |||| ||||||||||| ||| ||||| |
|
|
| T |
40078326 |
tacatctcttgatacaggtgttccttgggtcatgtgtcagcaaggagatgctcctgatccaatcgtaagtttt |
40078398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 203
Target Start/End: Complemental strand, 33891641 - 33891597
Alignment:
| Q |
159 |
agtaaaaggcaaaagaatagttcgatctgtgcttatcagacggtt |
203 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||||||| |||||| |
|
|
| T |
33891641 |
agtaaaaggcgaaagaatagttcgctatgtgcttatcacacggtt |
33891597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University