View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19406_low_27 (Length: 269)
Name: NF19406_low_27
Description: NF19406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19406_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 14 - 148
Target Start/End: Original strand, 42463482 - 42463615
Alignment:
| Q |
14 |
atatgttagtgttcatgtcgggggtgttagtgttcgtgttgggtccagtatccgtgcttcatagctacattgtaattgctatcagaagaaaataattttt |
113 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||||| ||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
42463482 |
atatgttagtgttcgtgtcggtg-tgttagtgttcgtgttgtgtccagtatccgtgcttcatagctataatgtaattgttatcagaagaaaataattttt |
42463580 |
T |
 |
| Q |
114 |
ggtttctcttgtagattgaattgaaatatgtgaaa |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463581 |
ggtttctcttgtagattgaattgaaatatgtgaaa |
42463615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 196 - 269
Target Start/End: Original strand, 42463663 - 42463736
Alignment:
| Q |
196 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctggt |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463663 |
gtgactgaagtgtaatgaaaatgtgattattcattcagagtgtacttggcattatacttggaggtggtgctggt |
42463736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University