View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19406_low_32 (Length: 243)
Name: NF19406_low_32
Description: NF19406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19406_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 79 - 222
Target Start/End: Original strand, 47700010 - 47700153
Alignment:
| Q |
79 |
gtttattttgacctcactcatagttaaggagggtttctcttgatataactttagtcttttatgtaatttctcaacaaggtgcaattttgtagaaatattt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47700010 |
gtttattttgacctcactcatagttaaggagggtttctcttgatataactttactcttctatgtaatttctcaacaaggtgcaattttgtagaaatattt |
47700109 |
T |
|
| Q |
179 |
cttggtgagtgttcagccctctaagactagtagaccaatcattt |
222 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
47700110 |
cttggcgagtgttcagccctttaagactggtagacaaatcattt |
47700153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University