View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19406_low_34 (Length: 228)
Name: NF19406_low_34
Description: NF19406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19406_low_34 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 212
Target Start/End: Complemental strand, 37116420 - 37116225
Alignment:
| Q |
17 |
ataaagcatcaatgcgctccaccaccttaaatatagtcaatttctaaataactatcagattgtttctttttacattgtttctatttacatggaccttact |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37116420 |
ataaagcatcaatgcgctccaccgccttaaatatagtcaatttctaaataactatccgattgtttctttttacattgcttctatttacatggaccttact |
37116321 |
T |
|
| Q |
117 |
tgaatcggataggcgccataccttagcacctttatgtattgggatagactttgatttggaaaaaagaagggggaaactattagcaccctgggtttt |
212 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37116320 |
tgaatcggataggtgccatatcttagcacctttatgtattgggatagactttgatttggaaaaaagaagggggaaactattagcaccctgggtttt |
37116225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University