View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19407_high_10 (Length: 343)
Name: NF19407_high_10
Description: NF19407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19407_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 123 - 325
Target Start/End: Complemental strand, 39830710 - 39830508
Alignment:
| Q |
123 |
cattggcgatcagaagtagacgttgaagtttcgctgtatagattgagagaattttgagcattttcgtcacacattgttaggtagggtcttctgctgccca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39830710 |
cattggcgatcagaagtagacgttgaagtttcgctgtatagattgagagaattttgagcattttcgtcacacattgttaggtagggtcttctgctgccca |
39830611 |
T |
 |
| Q |
223 |
caaatttcttctaggtcatcaactactagggaatataaatcatctcttttagcaattgattttcgttagatcgataataaaacaaacatgatacattata |
322 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39830610 |
caaatttcttctaggtcatcaactactagggaatataaatcatctcttttagcaattgattttcgttagatcgataataaaacaaacatgatatattata |
39830511 |
T |
 |
| Q |
323 |
gag |
325 |
Q |
| |
|
||| |
|
|
| T |
39830510 |
gag |
39830508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 10 - 74
Target Start/End: Complemental strand, 39830829 - 39830765
Alignment:
| Q |
10 |
attatacttggtaacaaatagataatatagactcttgaagtaaacaattgtatatatttcatatt |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
39830829 |
attatacttggtaacaaatagataatatagactcttcaagtaaacaattgtatacttttcatatt |
39830765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University