View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19407_high_15 (Length: 253)
Name: NF19407_high_15
Description: NF19407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19407_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 12394990 - 12395226
Alignment:
| Q |
1 |
aaatttgagaatcgggatgattggagtagttcgtgaggaatgtgattacagttttaccaagttcgtgagaaccaagcatagttttaatggcatttgcttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
12394990 |
aaatttgagaatcgggatgattggagtagttcatgaggaatgtgattacagctttaccaagttcgcgagaaccaagcatagttgtaatggcatttgcttt |
12395089 |
T |
|
| Q |
101 |
tgtagcatcaaatggtacatctagcttgttgcttgggtcaaatctagctttagcctgcagctcacgaatacaagtgggtatataattgttataaggagta |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12395090 |
tgtagcatcaaatggtatatctagcttgttgcttgggtcaaatctagctttagcctgcagctcacgaatacaagtgggtatataattgttataaggagta |
12395189 |
T |
|
| Q |
201 |
taacctatcatcctttcgttaaaattagacttgcaaa |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12395190 |
taacctatcatcctttcgttaaaattagatttgcaaa |
12395226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 34 - 115
Target Start/End: Original strand, 12356114 - 12356195
Alignment:
| Q |
34 |
tgaggaatgtgattacagttttaccaagttcgtgagaaccaagcatagttttaatggcatttgcttttgtagcatcaaatgg |
115 |
Q |
| |
|
|||||||||| ||||||||||||| ||| || ||| ||||||||||| | || | |||||||||||| ||||||||||| |
|
|
| T |
12356114 |
tgaggaatgtaattacagttttacaaagatcacaagagccaagcatagtggttatcgaatttgcttttgtggcatcaaatgg |
12356195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University