View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19407_high_9 (Length: 380)
Name: NF19407_high_9
Description: NF19407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19407_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 145 - 292
Target Start/End: Complemental strand, 10491933 - 10491781
Alignment:
| Q |
145 |
caccgctgatgaatgagagttaatatagtttaaattctagtagttacaatagcttggagtgcttttgcaagagaaatcaatatctac-----nnnnnnnn |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10491933 |
caccgctgatgaatgagagttaatatagtttaaaatctagtagttacaatagcttggagtgcttttgcaagagaaatcaatatctacttttttttttttt |
10491834 |
T |
|
| Q |
240 |
gttgacaaagcctacttattcatgatgattcaatatgctattgttttgtatgc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10491833 |
gttgacaaagcctacttattcatgatgattcaatatgctattgttttgtatgc |
10491781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 10492061 - 10492007
Alignment:
| Q |
17 |
acatagccctggggtaggacatcaaacaccacctccatgaagatgctagctagct |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10492061 |
acatagccctggggtaggacatcaaacaccacctccatgaagatgctagctagct |
10492007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 323 - 380
Target Start/End: Complemental strand, 10491751 - 10491694
Alignment:
| Q |
323 |
gcacttctatgttattaatattgtcgaaaaatgctcactgtcaacttcacccacgatt |
380 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10491751 |
gcacttctataatattaatattgtcgaaaaatgctcatcgtcaacttcacccacgatt |
10491694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University