View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_29 (Length: 336)
Name: NF19409_high_29
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 16 - 144
Target Start/End: Original strand, 32275324 - 32275452
Alignment:
| Q |
16 |
atgcagagatatattcacctcctgtttaccgattccacccatgcccaaggttacagccttgacggtcaatgcacaccttgcctccaacggtgttgtgttc |
115 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
32275324 |
atgcagagatagattcactacctgtttaccgattccacccatgcccaagcttgcagccttgacggtcattgcacaccttgcctccaacggtgttgggttc |
32275423 |
T |
|
| Q |
116 |
tccttgtcgtgaggatcctccatacttga |
144 |
Q |
| |
|
|||||||||||||| |||||||||||||| |
|
|
| T |
32275424 |
tccttgtcgtgaggctcctccatacttga |
32275452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 36 - 203
Target Start/End: Original strand, 32809087 - 32809244
Alignment:
| Q |
36 |
cctgtttaccgattccacccatgcccaaggttacagccttgacggtcaatgcacaccttgcctccaacggtgttgtgttctccttgtcgtgaggatcctc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
32809087 |
cctgtttaccgattccacccatgcccaaggttgcagcctt---------tgcacaccttgcctccaacggtgttgtggtctccttgtcgtgaggctcctc |
32809177 |
T |
|
| Q |
136 |
catacttgagnnnnnnngttgaagcaaaataacttgaccatgtgagtctctcacattgtggcatatat |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32809178 |
catacttgag-aaaaaggttgaagcaaaataacttgaccatgtgagtctctcacattgtggtatatat |
32809244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 36 - 145
Target Start/End: Original strand, 32269036 - 32269144
Alignment:
| Q |
36 |
cctgtttaccgattccacccatgcccaaggttacagccttgacggtcaatgcacaccttgcctccaacggtgttgtgttctccttgtcgtgaggatcctc |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||| ||||||| ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32269036 |
cctgtttaccgattccacccatgcccaaggttgcaaccttgacggtcattgcacac-ttgcctccaacggtgttgtgttctctttgtcgtgaggctcctc |
32269134 |
T |
|
| Q |
136 |
catacttgag |
145 |
Q |
| |
|
|||||||||| |
|
|
| T |
32269135 |
catacttgag |
32269144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 249
Target Start/End: Original strand, 32809241 - 32809277
Alignment:
| Q |
213 |
atatatttgtaagattggtgagaggcagataaatgat |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32809241 |
atatatttgtaagattggtgagagggagataaatgat |
32809277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 204 - 249
Target Start/End: Original strand, 32269167 - 32269212
Alignment:
| Q |
204 |
cacatgggaatatatttgtaagattggtgagaggcagataaatgat |
249 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||| ||||||||||| |
|
|
| T |
32269167 |
cacatgggtataaatttgtaagactggtgagagggagataaatgat |
32269212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University