View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_35 (Length: 307)
Name: NF19409_high_35
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 280
Target Start/End: Original strand, 52484268 - 52484507
Alignment:
| Q |
18 |
gtttacaatgatgaaaatagaagaaggtgtgaaccatgttgctatgaaagttgttgggtctgccatcgttgttaatttcttaatttggagggtttttgcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52484268 |
gtttacaatgatgaaaatagaagaaggtgtgaaccatgttgctatgaaagttgttgggtctgccatcgttgttaatttcttaatttggagggtttttgcg |
52484367 |
T |
 |
| Q |
118 |
ttgagatcgagcttcaacactgactgaagagtgaagacaatgtagggtgggggtgtaaatagagaaaggaaaatcaccatttacgtcttagtcatgtagt |
217 |
Q |
| |
|
|||| || ||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
52484368 |
ttga----gaccttcaac----actgaagagtgaa---------------gggtgtaaatagagaaaggaaaatcaccatttacgtc-tagtcatgtagt |
52484443 |
T |
 |
| Q |
218 |
cagaagaaaggag-aaaaaagttgataaataaataaatatcatgggggtggggaacttgtttct |
280 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52484444 |
cagaagaaaggagaaaaaaagttgataaataaataaatatcatgggggtggggaacttgtttct |
52484507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University