View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_40 (Length: 278)
Name: NF19409_high_40
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 263
Target Start/End: Complemental strand, 3660110 - 3659853
Alignment:
| Q |
18 |
cagaaggtgatgatgatgagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgagga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660110 |
cagaaggtgatgatgatgagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgagga |
3660011 |
T |
 |
| Q |
118 |
aggtttagagaatgaggagagcgttca------------tgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660010 |
aggtttagagaatgaggagagcgttcatgatgatgatgatgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaat |
3659911 |
T |
 |
| Q |
206 |
ggtgtctttgttcaaaggcaagtaattcaacctagagtgaagaagagtgtgagatttg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3659910 |
ggtgtctttgttcaaaggcaagtaattcaacctagagtgaagaagagtgtgagatttg |
3659853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University