View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_42 (Length: 274)
Name: NF19409_high_42
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 24325187 - 24324930
Alignment:
| Q |
1 |
gcattatttacacgctcccaagctactccagtg--gcgcggcaccaatttataaaacattatagagcacgctttgagtttgtaagctgagtcgactgcta |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24325187 |
gcattatttacacgctcccaagctactccagtgtggcgcgacaccaatttataaaacattatagagcacgctttgagtttgtaagctgagtcggctgcta |
24325088 |
T |
 |
| Q |
99 |
tggttttgtattctacaaaagctccaatgtccaaccgacacaatgcccctttttgacaatgatcttgtggagtttatggaagcgcaagaatttaaaattg |
198 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24325087 |
tggttttgtattctacaaaacctccaatgtccaaccgacacaatgcccctttttgacaatgatcttgtggagtttatggaagcgcaagaatttaaaattg |
24324988 |
T |
 |
| Q |
199 |
tgacggcaaatccatgaaacaaatgcacaaatacttaaacattccgtgcatatcttaa |
256 |
Q |
| |
|
||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24324987 |
tgatggcaaatccatgaaacaaatgcacaagtacttaaacattccgtgcatatcttaa |
24324930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 59 - 125
Target Start/End: Complemental strand, 40822725 - 40822657
Alignment:
| Q |
59 |
atagagcacgctttgagtttgtaagctgagtcgactgctatggtttt--gtattctacaaaagctccaa |
125 |
Q |
| |
|
||||||||| ||||||||||||| | | || | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
40822725 |
atagagcacactttgagtttgtatgataagcctgctgctatggttttttgtattctacaaaagctccaa |
40822657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University