View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_48 (Length: 255)
Name: NF19409_high_48
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_48 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 7 - 145
Target Start/End: Complemental strand, 12072668 - 12072530
Alignment:
| Q |
7 |
aagaatatttattgattgaaggaaaaaacaagtacaagcaagttttgattttaacataatgtttgaggcatgtcatgattatatatccattagatacttt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12072668 |
aagaatatttattgattgaaggaaaaaacaagtacaagcaagttttgattttaacataatgtttgaggcatgtcatgattatatatcaattagatacttt |
12072569 |
T |
 |
| Q |
107 |
tgtaccgtcttttgtttgcattatgagataatacataag |
145 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12072568 |
tgtaccgtcttttgtttgcattatgacataatacataag |
12072530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 186 - 240
Target Start/End: Complemental strand, 12072482 - 12072428
Alignment:
| Q |
186 |
ataaaccagaaaatacagattcaagatcaatgtcacaaattggcatgagttgcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12072482 |
ataaaccagaaaatacagattcaagatcaatgtcacaaattggcatgagttgcat |
12072428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University