View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_50 (Length: 251)
Name: NF19409_high_50
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 19301122 - 19300891
Alignment:
| Q |
1 |
ggtcgatttcctttggtgacagagtcttctgataacaattcagttgttgttgaagaaaaatcaccttctgttgataccaagtttgctgttatgaaccgtg |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19301122 |
ggtcgttttcctttggtgacagaatcttctgataacaattcagttgttgttgaagaaaaatcaccttctgttgataccaagtttgctgttatgaaccgtg |
19301023 |
T |
|
| Q |
101 |
gtaagaacattgttggtgctaaaaacaatggttttgagcttgctgagaagaagctgaacaaagacgggaagatgaaatcggtcgaaattggttatgtttc |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19301022 |
gtaagaacattgttggcgctaaaaacaatggttttgagcttgctgagaagaagctgaacaaagacgggaagatgaaatcggtcgaaattggttatgtttc |
19300923 |
T |
|
| Q |
201 |
tgataattcggattctggatacttcacttatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19300922 |
tgataattcggattctggatacttcacttatg |
19300891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University