View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_54 (Length: 243)
Name: NF19409_high_54
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 8994044 - 8994257
Alignment:
| Q |
20 |
gaagtgtgacgaagtcgtattcttaaagattagccgccttataagcccaatcccttcaagatttaacgatcttcccgggtatga----atatactcgagg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||| |
|
|
| T |
8994044 |
gaagtgtgacgaagtcgtattcttaaagaatagccgccttataagcccaatcccttcaagattcaacgatcttcccgagtatgaatgaatatactcgagg |
8994143 |
T |
 |
| Q |
116 |
ttatagaacaacttgaatttatccagaaaggaaaattagaagagtaaatggttttattgtttgctgagcgtgtatcctttttctccactggaagtgtgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8994144 |
ttatagaacaacttgaatttatccagaaagaaaaattagaagagtaaatggttttattgtttgctgagcgtgtatcctttttctccactggaagtgtgtt |
8994243 |
T |
 |
| Q |
216 |
atttacatcatatt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8994244 |
atttacatcatatt |
8994257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University