View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_high_59 (Length: 224)
Name: NF19409_high_59
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_high_59 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 26 - 211
Target Start/End: Complemental strand, 30620456 - 30620271
Alignment:
| Q |
26 |
aatttattagtccatttagattttgtaccatgaatctcgtgattttttcgaccttgttcttcttagcagtttaaaatttctctatgatcgagcaactaga |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620456 |
aatttattagtccatttagattttgtaccatgaatctcgtgattttttcgaccttgttcttcttagcagtttaaaatttctctatgatcgagcaactaga |
30620357 |
T |
 |
| Q |
126 |
tatggtttaaagtactcttaaccagaaccctaaaacataatttaccgaagcttttattctatatagcataatataatttacctaag |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30620356 |
tatggtttaaagtactcttaactagaaccctaaaacataatttaccgaagcttttattttatatagcataatataatttacctaag |
30620271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University