View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_low_37 (Length: 317)
Name: NF19409_low_37
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 83 - 311
Target Start/End: Complemental strand, 33213477 - 33213251
Alignment:
| Q |
83 |
tttggggagtgaaaaggatatgacacttgaactcgtgtttgtagtacttcatggcatgtagtattattggtttgtacatccctaactcattcatctttgt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33213477 |
tttggggagtgaaaaggatatgacacttgaactcgtgtttgta---cttcatggcatgtagtattattggtttgtatatccctaactcattcatctttgt |
33213381 |
T |
 |
| Q |
183 |
ggattgtgtattttagccttaataaagaacaccacgtttggtctcatagctcaactaaca-aaaatgacgaatgtcatgatcggattcgaacttcggtat |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||| |||||| || ||||| |
|
|
| T |
33213380 |
ggattgtgtattttagccttaataaagaacaccatgtttggtctcatagctcaactaacaaaaaatgatgaatgtcatgatcgggttcgaattttggtat |
33213281 |
T |
 |
| Q |
282 |
tttcacttgagtgtgtgagttgatgatgtc |
311 |
Q |
| |
|
| || |||||||||| |||| |||||||| |
|
|
| T |
33213280 |
ctccatttgagtgtgtaagtttatgatgtc |
33213251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University