View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19409_low_55 (Length: 251)

Name: NF19409_low_55
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19409_low_55
NF19409_low_55
[»] chr5 (1 HSPs)
chr5 (1-232)||(19300891-19301122)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 19301122 - 19300891
Alignment:
1 ggtcgatttcctttggtgacagagtcttctgataacaattcagttgttgttgaagaaaaatcaccttctgttgataccaagtttgctgttatgaaccgtg 100  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19301122 ggtcgttttcctttggtgacagaatcttctgataacaattcagttgttgttgaagaaaaatcaccttctgttgataccaagtttgctgttatgaaccgtg 19301023  T
101 gtaagaacattgttggtgctaaaaacaatggttttgagcttgctgagaagaagctgaacaaagacgggaagatgaaatcggtcgaaattggttatgtttc 200  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19301022 gtaagaacattgttggcgctaaaaacaatggttttgagcttgctgagaagaagctgaacaaagacgggaagatgaaatcggtcgaaattggttatgtttc 19300923  T
201 tgataattcggattctggatacttcacttatg 232  Q
    ||||||||||||||||||||||||||||||||    
19300922 tgataattcggattctggatacttcacttatg 19300891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University