View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19409_low_58 (Length: 249)

Name: NF19409_low_58
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19409_low_58
NF19409_low_58
[»] chr4 (2 HSPs)
chr4 (18-178)||(25890651-25890811)
chr4 (182-234)||(25887351-25887403)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 25890811 - 25890651
Alignment:
18 caatttacaaatgtgcattatccatgataagaaggatgaattgtttgatacctgaacaaacagaatggttaaaactaattcatatgttaaaattctagta 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||    
25890811 caatttacaaatgtgcattatccatgataagaaggatgaattgtttgatacctgaacaaacagaatggttaaaactaactcatatgttaaaattgtagta 25890712  T
118 taaatgataatatgatcatacatttgcaagatagaactaaatatagtcacttctatgtgaa 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25890711 taaatgataatatgatcatacatttgcaagatagaactaaatatagtcacttctatgtgaa 25890651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25887403 - 25887351
Alignment:
182 atgttgattcagttgatggtaaagagttgattcatattcggcaaagatgtagg 234  Q
    ||||||||||||||| |||||||||||| ||||||||||||||||||||||||    
25887403 atgttgattcagttggtggtaaagagttaattcatattcggcaaagatgtagg 25887351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University