View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_low_58 (Length: 249)
Name: NF19409_low_58
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 25890811 - 25890651
Alignment:
| Q |
18 |
caatttacaaatgtgcattatccatgataagaaggatgaattgtttgatacctgaacaaacagaatggttaaaactaattcatatgttaaaattctagta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
25890811 |
caatttacaaatgtgcattatccatgataagaaggatgaattgtttgatacctgaacaaacagaatggttaaaactaactcatatgttaaaattgtagta |
25890712 |
T |
 |
| Q |
118 |
taaatgataatatgatcatacatttgcaagatagaactaaatatagtcacttctatgtgaa |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25890711 |
taaatgataatatgatcatacatttgcaagatagaactaaatatagtcacttctatgtgaa |
25890651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 182 - 234
Target Start/End: Complemental strand, 25887403 - 25887351
Alignment:
| Q |
182 |
atgttgattcagttgatggtaaagagttgattcatattcggcaaagatgtagg |
234 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25887403 |
atgttgattcagttggtggtaaagagttaattcatattcggcaaagatgtagg |
25887351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University