View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19409_low_62 (Length: 240)
Name: NF19409_low_62
Description: NF19409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19409_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 15051997 - 15051772
Alignment:
| Q |
1 |
gattagtattttatttaatactttatgaaatggaaccttgtgatctaatggtattnnnnnnnntgttataccagctgggagagatatataattatttatc |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15051997 |
gattaggattttatttaatactttatgaaatggaaccttgtgatctaatggtattaaaaaaaatgttataccagctgggagagatatataattatttatg |
15051898 |
T |
 |
| Q |
101 |
attacatgattaatttcgttgcatactattgaagtcatctttctgttagtaagattaacaatctaatcaataacaatatagtaagatactctttgcatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15051897 |
attacatgattaatttcgttgcatactattgaagtcaactttctgttagtaagattaacaatctaatcaataacgatatagtaagatactctttgcatga |
15051798 |
T |
 |
| Q |
201 |
agacaaatggatttgcatgacattgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
15051797 |
agacaaatggatttgcatgacattgt |
15051772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 108 - 180
Target Start/End: Complemental strand, 13032927 - 13032855
Alignment:
| Q |
108 |
gattaatttcgttgcatactattgaagtcatctttctgttagtaagattaacaatctaatcaataacaatata |
180 |
Q |
| |
|
||||||||||| || ||||| |||||||| ||||||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
13032927 |
gattaatttcgctgtatactcatgaagtcaactttctgttagtaagattaacaatccaatcaacaacgatata |
13032855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 15215214 - 15215249
Alignment:
| Q |
1 |
gattagtattttatttaatactttatgaaatggaac |
36 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15215214 |
gattaggattttatttaatactttatgaaatggaac |
15215249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University