View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1940_low_5 (Length: 297)
Name: NF1940_low_5
Description: NF1940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1940_low_5 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 297
Target Start/End: Original strand, 56068107 - 56068408
Alignment:
| Q |
11 |
agaatatgcagagcctcttaagggttatcttctcaagtatagggaaattgaaggagacaagaatttctctatgaatatgattggtagtagtaaggagcag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56068107 |
agaatatgcagagcctcttaagggttatcttctcaagtatagggaaattgaaggagacaagaatttctctatgaatatgattggtagtaataaggagcag |
56068206 |
T |
 |
| Q |
111 |
caaggtagtattcatcgattcttccaaggttaattatatttgcaacaactaatagcaggtttatttgtttatttatgcctctttttgaggcttttaatgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
56068207 |
gaaggtagtattcatcgattcttccaaggttaattatatttgcaacaactaatagcaggtttatttgtttatttatgcctccttttgaggcttttaatgt |
56068306 |
T |
 |
| Q |
211 |
ctgattgcagaactatacactagtttgtta---------------ttgttgttgagattataatatacacattaagtatagtgatgatttgtatttttgt |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56068307 |
ttgattgcagaactatacactagtttgttattgttgtttgtatttttgttgttgagattataatatacacattaagtatagtgatgatttgtatttttgt |
56068406 |
T |
 |
| Q |
296 |
tt |
297 |
Q |
| |
|
|| |
|
|
| T |
56068407 |
tt |
56068408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University