View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1940_low_6 (Length: 278)
Name: NF1940_low_6
Description: NF1940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1940_low_6 |
 | |
|
| [»] scaffold0534 (1 HSPs) |
| | |
|
| [»] scaffold0042 (1 HSPs) |
| | |
|
| [»] scaffold0599 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 3233715 - 3233976
Alignment:
| Q |
1 |
atctaaaagaatggagcatgattcaaaagtaagattaatcttaaaatttagatcgggtctaactccattatcatcgcttttcttctattcaccttgagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||| ||| | |
|
|
| T |
3233715 |
atctaaaagaatggagcatgattcaaaagtaagattaatcttaaaatttagattgggtctaactcgattatcatcgtttttcttctattcacctcgagct |
3233814 |
T |
|
| Q |
101 |
aatactcattgttgcaatgatcacatctattaggtggtactcagaatgtagattgggagagtttggattgagcaaaagggatcttttaatggcctattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||| |||||||||||||||||||| ||| || ||||||| | | |
|
|
| T |
3233815 |
aatactcattgttgcaatgatcacatttattaggtggtactcagaatctagattaggagaatttggattgagcaaaagggaacttctattggcctacttt |
3233914 |
T |
|
| Q |
201 |
ttagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
|| |||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3233915 |
ttggcagcagcaaacatatttgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
3233976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 3179723 - 3179464
Alignment:
| Q |
1 |
atctaaaagaatggagcatgattcaaaagtaagatt-aatcttaaaatttagatcgggtctaactccattatcatcgcttttcttctattcaccttgagt |
99 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||||||| || ||||||| ||||||||| | ||| ||| |
|
|
| T |
3179723 |
atctaaaagaatggagcatgatccaaaagtaagatttaatcttaaaatttagatcaagtctaactcgat---catcgctcttcttctatccccctcgagc |
3179627 |
T |
|
| Q |
100 |
taatactcattgttgcaatgatcacatctattaggtggtactcagaatgtagattgggagagtttggattgagcaaaagggatcttttaatggcctatta |
199 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3179626 |
taatactccttgctgcaatgatcacatttattaggtggtactcagaatgtagattgggagagtttggattgagcaaaagggatcttttaatgtcctattt |
3179527 |
T |
|
| Q |
200 |
tttagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3179526 |
tttagcagcagcaagcatatttcagcctgaaaggtctcaagagagacttgcatgggccaaaac |
3179464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 6 - 262
Target Start/End: Original strand, 3214112 - 3214365
Alignment:
| Q |
6 |
aaagaatggagcatgattcaaaagtaagattaatcttaaaatttagatcgggtctaactccattatcatcgcttttcttctattcaccttgagttaatac |
105 |
Q |
| |
|
||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||| | ||||| |||| | |
|
|
| T |
3214112 |
aaagagtgaagcatgactcaaaagtaagattaatcttaaaatttagatcgggtctaacttgattatc---gctcttcttctattccctttgagctaatgc |
3214208 |
T |
|
| Q |
106 |
tcattgttgcaatgatcacatctattaggtggtactcagaatgtagattgggagagtttggattgagcaaaagggatcttttaatggcctattatttagc |
205 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
3214209 |
tcattgttgcaatgatcacatttattaggtggtactcagaatctaaattgggagagtttggattgagcaaaagggatcttttattggcctattttttagc |
3214308 |
T |
|
| Q |
206 |
agcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
||||| ||| |||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3214309 |
agcagaaagtatatttgagcctgaaaggtctcaagagagacttgcatgggccaaaac |
3214365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 195 - 262
Target Start/End: Original strand, 37960333 - 37960400
Alignment:
| Q |
195 |
tattatttagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
|||||| ||||||| || | ||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
37960333 |
tattatgtagcagcggccaacatatttgagcctgagaggtctctagagagacttgcatgggctaaaac |
37960400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 161 - 262
Target Start/End: Complemental strand, 12634402 - 12634301
Alignment:
| Q |
161 |
gtttggattgagcaaaagggatcttttaatggcctattatttagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaa |
260 |
Q |
| |
|
||||||||||||||||| | ||| |||| || |||||| ||||||| || ||||||| |||||| || ||||||| ||||||||||||||||| ||| |
|
|
| T |
12634402 |
gtttggattgagcaaaaagagtctcctaattgcttattatgtagcagcggctagcatatttgagcccgagaggtctctagagagacttgcatgggctaaa |
12634303 |
T |
|
| Q |
261 |
ac |
262 |
Q |
| |
|
|| |
|
|
| T |
12634302 |
ac |
12634301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0534 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0534
Description:
Target: scaffold0534; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 195 - 262
Target Start/End: Original strand, 9133 - 9200
Alignment:
| Q |
195 |
tattatttagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
|||||| ||||||| || ||||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
9133 |
tattatgtagcagcggccagcatatttgagcctgagaggtctctagagagacttgcatgggcaaaaac |
9200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 195 - 262
Target Start/End: Original strand, 28049878 - 28049945
Alignment:
| Q |
195 |
tattatttagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
|||||| ||||||| || ||||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
28049878 |
tattatgtagcagcggccagcatatttgagcctgagaggtctctagagagacttgcatgggcaaaaac |
28049945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0042 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0042
Description:
Target: scaffold0042; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 262
Target Start/End: Complemental strand, 11299 - 11239
Alignment:
| Q |
202 |
tagcagcagcaagcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
||||||| || ||||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
11299 |
tagcagctgccagcatatttgagcctgagaggtctctagagagacttgcatgggcaaaaac |
11239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0599 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0599
Description:
Target: scaffold0599; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 3311 - 3360
Alignment:
| Q |
213 |
agcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
||||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
3311 |
agcatatttgagcctgagaggtctctagagagacttgcatgggcaaaaac |
3360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 262
Target Start/End: Original strand, 11911617 - 11911666
Alignment:
| Q |
213 |
agcatatatgagcctgaaaggtctcatgagagacttgcatgggccaaaac |
262 |
Q |
| |
|
||||||| ||||||||| ||||||| ||||||||||||||||| ||||| |
|
|
| T |
11911617 |
agcatatttgagcctgagaggtctctagagagacttgcatgggcaaaaac |
11911666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University