View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19410_low_5 (Length: 245)
Name: NF19410_low_5
Description: NF19410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19410_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 16 - 230
Target Start/End: Original strand, 4280959 - 4281176
Alignment:
| Q |
16 |
atcagactgaggagtatcttcaaca---tgagttttttcagcaagatttcgcagttttgaagctgctgccagaagtgcatcatgctcctgcttattgatg |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4280959 |
atcagactgaggagtatcttcaacaacatgatttttttcagcaagatttcgcagttttgaagctgctgccagaagtgcatcatgctcctgcttattgatg |
4281058 |
T |
 |
| Q |
113 |
ccgccagtttctgtattctgtgcaagggatatgggagtgactccattaagaatcccaaaacccttaggatcctttggcttctttttcttatgcactacat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4281059 |
ccgccagtttctgtattctgtgcaagggatatgggagtgactccattaagaatcccaaaacccttaggatcctttggcttctttttcttatgcactacat |
4281158 |
T |
 |
| Q |
213 |
cacgcagttgtactttgt |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4281159 |
cacgcagttgtactttgt |
4281176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University