View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19411_low_10 (Length: 225)
Name: NF19411_low_10
Description: NF19411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19411_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 31868810 - 31869018
Alignment:
| Q |
1 |
gctaaagtagtaggaagaggaagaggttgagagtttgcacttgtaggcattgatacttgagaagaaatgaaactagctgcttctctatatttgtatttta |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868810 |
gctaaagtcgtaggaagaggaagaggttgagagtttgcacttgtaggcattgatacttgagaagaaatgaaactagctgcttctctatatttgtatttta |
31868909 |
T |
 |
| Q |
101 |
gtagctcagttcttactgcatgtaactctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctcttaa |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31868910 |
gtagctcagttcttactgcatgcaactctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctcttaa |
31869009 |
T |
 |
| Q |
201 |
ccttaaatt |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
31869010 |
ccttaaatt |
31869018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 139 - 199
Target Start/End: Original strand, 36231903 - 36231963
Alignment:
| Q |
139 |
gattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctctta |
199 |
Q |
| |
|
||||| ||||||||||| || ||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
36231903 |
gattgaacttgttgttgcaaagatgaaattgcacccatgcatccataaactggatctctta |
36231963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 127 - 199
Target Start/End: Original strand, 43200634 - 43200706
Alignment:
| Q |
127 |
tctgcttgtaaagattggacttgttgttgtaatgatgatattgcacccatgcatccataaacaggatctctta |
199 |
Q |
| |
|
||||||||||||||||| || |||||||| |||| || ||||||||||||||||||||||| |||||||||| |
|
|
| T |
43200634 |
tctgcttgtaaagattgaacctgttgttgcaatgcagaaattgcacccatgcatccataaactggatctctta |
43200706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University