View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19411_low_5 (Length: 289)
Name: NF19411_low_5
Description: NF19411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19411_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 14 - 288
Target Start/End: Original strand, 40741199 - 40741473
Alignment:
| Q |
14 |
ccaaaaaggcagatcataatgcttggttaaagtttttcaaagaggggttagaagcagaaagtgacaaactttatgaaattgagcatgtgggttttctttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40741199 |
ccaaaaaggcagatcataatgcttggttaaagtttttcaaagaggggttagaagcagaaagtgacaaactttttgaaattgagcatgtgggttttctttg |
40741298 |
T |
 |
| Q |
114 |
tttatggttatcaaggttcgtttttccttcattttctgattctgttatcgacccgcgtgtttttccaattgctattcatttatctcaaggtacaagaatg |
213 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741299 |
tttatggttatcaaggtttgtttttccttcattttctgattctgttatcgacccgcgtgtttttccaattgctattcatttatctcaaggtacaagaatg |
40741398 |
T |
 |
| Q |
214 |
gctcttgcaccttctgttcttgccagtatttatcataatttgagtttgcttaaagaaaaactagtttcttcatct |
288 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
40741399 |
gctcttgcaccttctgttcttgctagtatttatcataatttgacttttcttaaagaaaaactagtttcttcatct |
40741473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University