View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19411_low_8 (Length: 236)

Name: NF19411_low_8
Description: NF19411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19411_low_8
NF19411_low_8
[»] chr4 (1 HSPs)
chr4 (116-163)||(48710898-48710942)


Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 163
Target Start/End: Original strand, 48710898 - 48710942
Alignment:
116 aattctctccctctttcacgtgagtttattactagacaagcaaggaac 163  Q
    |||||||||||||||||||||||||   ||||||||||||||||||||    
48710898 aattctctccctctttcacgtgagt---ttactagacaagcaaggaac 48710942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University