View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19411_low_8 (Length: 236)
Name: NF19411_low_8
Description: NF19411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19411_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 116 - 163
Target Start/End: Original strand, 48710898 - 48710942
Alignment:
| Q |
116 |
aattctctccctctttcacgtgagtttattactagacaagcaaggaac |
163 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
48710898 |
aattctctccctctttcacgtgagt---ttactagacaagcaaggaac |
48710942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University