View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19412_high_5 (Length: 406)
Name: NF19412_high_5
Description: NF19412
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19412_high_5 |
 | |
|
| [»] scaffold0070 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 101 - 390
Target Start/End: Complemental strand, 22209331 - 22209042
Alignment:
| Q |
101 |
tgagagtgaatgtgttacaaatagaatttggaatttgttcttgatgaaaaataaaaattggaattcgcatgtcttttgcagcgtagagtgagataattga |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22209331 |
tgagagagaatgtgttacaaatagaatttggaatttgttcttgatgaaaaataaaaattggaatttgcatgtcttttgcagcgtagagtgagataattga |
22209232 |
T |
|
| Q |
201 |
gaagttgggctattttgtttggtcgaaaggagttggactggacctgaatccataacatgctagaaagagatggtttctctttgaaaaatgtttttcttcc |
300 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22209231 |
gaagttgggcttttttgtttggtcaaaaggagttggactggacctgaatccataacatgctagaaagagatggtttctctttgaaaaatgcttttcttcc |
22209132 |
T |
|
| Q |
301 |
aagcgtttttgctcattaacacctcaaacttccagaattaactcacacgtaagttaattaagtcatgttcgaaataaccaatgtgagtta |
390 |
Q |
| |
|
||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22209131 |
aagtgtttttgctcattaccacctcaaacttccagaattaactcacacataagttaattaagtcatgttcgaaataaccaatgtaagtta |
22209042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 294 - 338
Target Start/End: Original strand, 45325 - 45369
Alignment:
| Q |
294 |
ttcttccaagcgtttttgctcattaacacctcaaacttccagaat |
338 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
45325 |
ttctcccaagcgtttttgctcattctcacctcaaaattccagaat |
45369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University