View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19413_high_23 (Length: 215)
Name: NF19413_high_23
Description: NF19413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19413_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 28 - 198
Target Start/End: Original strand, 18697503 - 18697671
Alignment:
| Q |
28 |
cgataagcggtgcagactttcctctctttgctctttccaaaaaatcaatggttttaattaattttttcagtatcttctccatttgtctcttaaaaagctt |
127 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18697503 |
cgataagcggagcagactttcctctctttgctctttccaaaaaatcaatggttttaattaattttttcagtatcttctccatttgtctcttaaaaggctt |
18697602 |
T |
|
| Q |
128 |
ctttgcttcctgaagtaaaatctgagtttcttcgtagtctctttccattatttttccctacagatcctttg |
198 |
Q |
| |
|
|||||||||||||||| ||| |||||||| || ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
18697603 |
ctttgcttcctgaagtgaaacctgagtttgtttgtagtctctttccgtta--tttccctacagatcctttg |
18697671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 28 - 111
Target Start/End: Original strand, 33946078 - 33946161
Alignment:
| Q |
28 |
cgataagcggtgcagactttcctctctttgctctttccaaaaaatcaatggttttaattaattttttcagtatcttctccattt |
111 |
Q |
| |
|
|||| ||||| ||||||| | ||||||| ||||||||||||||||| ||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
33946078 |
cgattagcggagcagactcttctctcttagctctttccaaaaaatccatggttttacttaattttttcagtttcttctccattt |
33946161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University