View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19413_high_25 (Length: 205)
Name: NF19413_high_25
Description: NF19413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19413_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 23772114 - 23771942
Alignment:
| Q |
15 |
aatatcatgtgttagaagatgtggtgaattccatgtcctgcacttatatgcatagcaatgtgtcgtcaatatcaatatgaggaggtagtgaatattttaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23772114 |
aatatcatgtgttagaagatgtggtgaattgcatgtcctgcacttatatgcatagcaatgtgtcgtcaatatcaatatgaggaggtagtgaatattttaa |
23772015 |
T |
 |
| Q |
115 |
gcaaaggatcgaactagccaaaacacaaacacaacatgcagtttgtacatttaattggaactaagccttttat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23772014 |
gcaaaggatcgaactagccaaaacacaaacacaacatgcagtttgtacatttaattggaactaagccttttat |
23771942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 73 - 181
Target Start/End: Complemental strand, 23775139 - 23775025
Alignment:
| Q |
73 |
tgtgtcgtcaatatcaatatgaggaggtagtg---aatatt-tta--agcaaaggatcgaactagccaaaacacaaacacaacatgcagtttgtacattt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||| ||| |||||||||||||||| || |||| ||||||||||||||||||||||| | || |
|
|
| T |
23775139 |
tgtgtcgtcaatatcaatatgaggaggtagtggtgagtattgttatgagcaaaggatcgaacttgcaaaaatacaaacacaacatgcagtttgtataatt |
23775040 |
T |
 |
| Q |
167 |
aattggaactaagcc |
181 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23775039 |
aattggaactaagcc |
23775025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 61
Target Start/End: Complemental strand, 23778003 - 23777957
Alignment:
| Q |
15 |
aatatcatgtgttagaagatgtggtgaattccatgtcctgcacttat |
61 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23778003 |
aatataatgtgttagaagatgtggtgaattccatgtcctccacttat |
23777957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University