View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19413_low_14 (Length: 312)
Name: NF19413_low_14
Description: NF19413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19413_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 16 - 299
Target Start/End: Original strand, 7993378 - 7993661
Alignment:
| Q |
16 |
gatgcatcgcggacttttctatgtcgcctattcaaaagattcactaaccttaactccctcaacctctcgaactaccgttgtgaccttgacaaggttctcc |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| | |
|
|
| T |
7993378 |
gatgcatcgcggacttttctatgtcgcatattcgaaagattcactaaccttaactccctcaacctctcgaactaccattgtgaccttgacaagtttctgc |
7993477 |
T |
|
| Q |
116 |
gggaaatctctactttcccatcattgaacatcacatcccttaatatctccgaccaaggcatctttcccggctatggtctgcgagcatttgcgcaaaacat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
7993478 |
gggaaatctctactttcccatcattgaacatcacatcccttaatatctccgaccaatgcaactttcccgcctatggtttgcgagcatttgcccaaaacat |
7993577 |
T |
|
| Q |
216 |
taaaactttgacctctctcaattgttccaatacttttcttggtaagggcggcctgttattcattgccaactgtttccctttgct |
299 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
7993578 |
tacaattttgacctctctcaattgttccaatacttttcttggtaagggcggcctgttactcattgccaattgtttccctttgct |
7993661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 171
Target Start/End: Complemental strand, 6417298 - 6417164
Alignment:
| Q |
37 |
tgtcgcctattcaaaagattcactaaccttaactccctcaacctctcgaactaccgttgtgaccttgacaaggttctccgggaaatctctactttcccat |
136 |
Q |
| |
|
|||||||| || ||||||||||| |||||||| |||||||||||| | || | | | |||||||| ||||||| |||||||| ||| |||| |
|
|
| T |
6417298 |
tgtcgcctctttaaaagattcacaaaccttaattccctcaacctcacacgctttcatggcgaccttgatgctcttctccgtaaaatctctcgttttccat |
6417199 |
T |
|
| Q |
137 |
cattgaacatcacatcccttaatatctccgaccaa |
171 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||| |
|
|
| T |
6417198 |
cattgaacatcacatcacttaatatctccaaccaa |
6417164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 209 - 245
Target Start/End: Original strand, 8913442 - 8913478
Alignment:
| Q |
209 |
aaaacattaaaactttgacctctctcaattgttccaa |
245 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
8913442 |
aaaagattacaactttgacctctctcaattgttccaa |
8913478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 49 - 171
Target Start/End: Complemental strand, 10615907 - 10615785
Alignment:
| Q |
49 |
aaaagattcactaaccttaactccctcaacctctcgaactaccgttgtgaccttgacaaggttctccgggaaatctctactttcccatcattgaacatca |
148 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| | || || ||||||||||| ||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
10615907 |
aaaagattcacaaaccttaattccctcaacctcacacgcttccacggtgaccttgacgctcttctccgcaaaatctctcgtttcccatcattgaacatca |
10615808 |
T |
|
| Q |
149 |
catcccttaatatctccgaccaa |
171 |
Q |
| |
|
|||| |||||||| ||| ||||| |
|
|
| T |
10615807 |
catcacttaatatttccaaccaa |
10615785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University