View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19413_low_17 (Length: 285)
Name: NF19413_low_17
Description: NF19413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19413_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 8629355 - 8629204
Alignment:
| Q |
1 |
ccctcctttacgtctctgtgccgtttgtttctgcgccgccgttgttgctgttgttaccgtgacggtggtatccgtggttgttgactgattccgtttacgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8629355 |
ccctcctttacgtctctgtgccgtttgtttctgcgccgccgttgttgctgttgttaccgtgacggtggtatccgtggttgttgactgattccgtttacgg |
8629256 |
T |
|
| Q |
101 |
ttatcattgtttgtggtgttgctgttagaaccactaacaacctttgtagaag |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8629255 |
ttatcattgtttgtggtgttgctgttagaaccactaacaacctttgtagaag |
8629204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 218 - 285
Target Start/End: Complemental strand, 8629138 - 8629071
Alignment:
| Q |
218 |
tgatcattgatttagaaattagaaagcgtgtgagatgattgagattgagaagaaggaaggaatgtggc |
285 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8629138 |
tgatcattgatttagaaattggaaagcgtgtgagatgattgagattgagaagaaggaaggaatgtggc |
8629071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University