View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19414_low_13 (Length: 325)
Name: NF19414_low_13
Description: NF19414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19414_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 3e-79; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 43 - 270
Target Start/End: Complemental strand, 7309837 - 7309613
Alignment:
| Q |
43 |
aacttgtttggttaatgtacttattttatagagtctattttcacccgagctaaaactccattgctctatatgagttattttattgatttctgtcaatgtt |
142 |
Q |
| |
|
|||||||||| ||| |||||| ||||||||||| ||||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||| ||||| |
|
|
| T |
7309837 |
aacttgtttgtttattgtactaattttatagagcctattttcacccgagctaaaactccattgctatttatgagttattttattgatgtctgtttatgtt |
7309738 |
T |
 |
| Q |
143 |
gaacttattatctttatattgatatacatatgcaacattaatgtatgataatttcataagtgtaatttattgttaaaaattgttgttgttttataaccaa |
242 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7309737 |
aaacgtat---ctttatattgatatacatatgcaacattaatgtatgatagtttgataagtgtaatttattgttaaaaattgttgttgttctataaccaa |
7309641 |
T |
 |
| Q |
243 |
aaataacaaattgcaaatcataccaaat |
270 |
Q |
| |
|
||||||||||||| ||||| |||||||| |
|
|
| T |
7309640 |
aaataacaaattgtaaatcgtaccaaat |
7309613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 151 - 243
Target Start/End: Original strand, 7332080 - 7332167
Alignment:
| Q |
151 |
tatctttatattgatatacatatgcaacattaatgtatgataatttcataagtgtaatttattgttaaaaattgttgttgttttataaccaaa |
243 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7332080 |
tatctttatattgatata--tatgcaacattaatgtatgataatttgataagtgtaatttattgttaaaaattgt---tgttttataaccaaa |
7332167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 43 - 102
Target Start/End: Original strand, 7330124 - 7330181
Alignment:
| Q |
43 |
aacttgtttggttaatgtacttattttatagagtctattttcacccgagctaaaactcca |
102 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7330124 |
aacttgtttggttattgtactcattttatag--tctattttcacccgagctaaaactcca |
7330181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University