View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19414_low_18 (Length: 296)
Name: NF19414_low_18
Description: NF19414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19414_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 9e-76; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 132 - 289
Target Start/End: Original strand, 33252889 - 33253043
Alignment:
| Q |
132 |
tcatgttacaaaaaagatgatatcttcattatttacattatgtggttgaaacaagtatatataatccatcctttatgtacatctatcaagccttatgact |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252889 |
tcatgttacaaaaaagatgatatcttcattatttacattatgtggttgaaacaagtatatataatccatcctttatgtacatctatcaagccttatgact |
33252988 |
T |
 |
| Q |
232 |
ggtctacatgaccaatagagccgcattatgtgtgtgaataattttagagtttgatgat |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33252989 |
ggtctacatg---aatagagccgcattatgtgtgtgaataattttagagtttgatgat |
33253043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 33252425 - 33252483
Alignment:
| Q |
1 |
tattgggaatcatattcttggacggtggggtcatattgatgcaaccatcttaattatta |
59 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33252425 |
tattaggaatcataatcttggacggtggtgtcatattgatgcaaccatcttaattatta |
33252483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 51 - 108
Target Start/End: Original strand, 33252799 - 33252865
Alignment:
| Q |
51 |
taattattaaataaatataggttaaggaac---------taacacattttggagatcttggcataag |
108 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
33252799 |
taattattaaataaatataggttaatgaactaaagtatgtaacacattttggagatcttggcataag |
33252865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University