View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19414_low_20 (Length: 269)
Name: NF19414_low_20
Description: NF19414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19414_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 31292140 - 31292046
Alignment:
| Q |
1 |
tggaaaaagaacgttgacgtgtaagttatttttctactactagtatgattccttcaa-taaacaatgtacttcatttatgttgtaataaaactat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||| ||||| ||||| |
|
|
| T |
31292140 |
tggaaaaagaacgttgacgtgtaagttatttttctactactagtatgattccttcaattgaacaacatacttcatttatgttgcaataatactat |
31292046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 94 - 122
Target Start/End: Original strand, 45830892 - 45830920
Alignment:
| Q |
94 |
ttttgatctgataaattttgttgcttttg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45830892 |
ttttgatctgataaattttgttgcttttg |
45830920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University