View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19414_low_24 (Length: 255)
Name: NF19414_low_24
Description: NF19414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19414_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 11 - 238
Target Start/End: Complemental strand, 40736282 - 40736053
Alignment:
| Q |
11 |
atcatcaactatacgataggaataacagcaaatacaagcacatccttctccgacatgcccattttttctttcaattcggtacctctatattattttttct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736282 |
atcatcaactatacgataggaataacagcaaatacaagcacatccttctccgacatgcccattttttctttcaattcggtacctctatattattttttct |
40736183 |
T |
 |
| Q |
111 |
gatgtaaccttgcaaatcctcgcaggtat--acacgccctaagctatatgtctgaagttttccttgagtacattttttgtaacccttttataactgagtt |
208 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40736182 |
gatgtaaccttgcaagtcctcgcaggtatacacacgccctaagctatatgtctgaagttttccttgagtacattttttgtaacccttttataactgagtt |
40736083 |
T |
 |
| Q |
209 |
ctacttcggtgtaaccggcccgtagctaat |
238 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
40736082 |
ctacttcggtgtaaccggcccgtaactaat |
40736053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University