View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19415_low_1 (Length: 260)
Name: NF19415_low_1
Description: NF19415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19415_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 20 - 242
Target Start/End: Original strand, 33885117 - 33885339
Alignment:
| Q |
20 |
atggattaacaattgtattagagtgttcaactcaataatatgttacaatgttttcctcatctttgatcttcttgatgctgttttatgtgttatctataga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885117 |
atggattaacaattgtattagagtgttcaactcaataatatgttacattgttttcctcatctttgatcttcttgatgctgttttatgtgttatctataga |
33885216 |
T |
|
| Q |
120 |
taccttgatgaacgcattgatggggtggcctcttcttgttgttgctctaaatgggagatacagaagaagatggtgatgaatgatgaagatgatggtgttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885217 |
taccttgatgaacgcattgatggggtggcctcttcttgttgttgctctaaatgggagagacagaagaagatggtgatgaatgatgaagatgatggtgttt |
33885316 |
T |
|
| Q |
220 |
cagaaagtttgtatgagaggaag |
242 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
33885317 |
cagaaagtttgtatgagaggaag |
33885339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University