View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19416_high_11 (Length: 293)
Name: NF19416_high_11
Description: NF19416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19416_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 12306071 - 12306338
Alignment:
| Q |
19 |
gatattagcccctaccacatatatattttttgcatcagcaattccagttatttcatttggagaacaattgcaaagagatacaggtacattgttaatttta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12306071 |
gatattagcccctaccacatatatattttttgcatcagcaattccagttatttcatttggagaacaattgcaaagagatacaggtacattgttaatttca |
12306170 |
T |
|
| Q |
119 |
tcgatgcatgaaatcttgctatataaaaagcgatgataatttagtatatcttcaattgaatgttatgtgtaccaacaatgtctagatgggatactcactg |
218 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12306171 |
tcgatgcatggaatcttgttatataaaaagcaatgataatttagtatatcttcaattgaatgttatgtgtaccaacaatgtctagatgggatactcactg |
12306270 |
T |
|
| Q |
219 |
ctatacaaacattagcatctactgcactgtgtggaattatacactctattattggaggccagcctttg |
286 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12306271 |
ctgtacaaacattagcatctactgcactgtgtggaattatacactctattattggaggccagcctttg |
12306338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 35 - 81
Target Start/End: Complemental strand, 34927292 - 34927246
Alignment:
| Q |
35 |
acatatatattttttgcatcagcaattccagttatttcatttggaga |
81 |
Q |
| |
|
||||| ||||||||||| ||||||||||| |||||||| |||||||| |
|
|
| T |
34927292 |
acatacatattttttgcttcagcaattcctgttatttcttttggaga |
34927246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University