View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19416_high_16 (Length: 227)
Name: NF19416_high_16
Description: NF19416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19416_high_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 46838167 - 46837941
Alignment:
| Q |
1 |
ggctgacaggactaaagtattttattcttctgagtataaatactaaaatgttgtttaatgaatatactgtcacacacaaagagtgatttatacgtacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46838167 |
ggctgacaggactaaagtattttattcttctgagtataaatactaaaatgttgtttaatgaatatactgtcacacacaaagactgatttatacgtacaac |
46838068 |
T |
 |
| Q |
101 |
agggcgctgtgacaccatcccttgagcttgaagttagctcaaaatatcttctgcttcaagagatgagtacttgaggatggcagcaagaatcctttctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46838067 |
agggcgctgtgacaccatcccttgagcttgaagttagctcaaaatatcttctgcttcaagagatgagtacttgaggatggcagcaagaatcctttctttg |
46837968 |
T |
 |
| Q |
201 |
tctctggttgggaatgcttccaacagt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
46837967 |
tctctggttgggaatgcttccaacagt |
46837941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University