View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19416_low_10 (Length: 325)
Name: NF19416_low_10
Description: NF19416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19416_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 304
Target Start/End: Original strand, 46837396 - 46837697
Alignment:
| Q |
1 |
tttgctttatcattgactctcaaactagagatttt-attcgattaataattagattgagaaagttaacttttatcaagactcttagttatcactccgctc |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46837396 |
tttgctttatcattgactctcaaactagagatttttattcgattaataattagattgagaaagttaacttttatcaagactcttagttatcactcccctc |
46837495 |
T |
|
| Q |
100 |
ttattgcaggtgattgatgagtatgatgaagaatccgaggttgcggaacgacttagaatcagggtatttatttctcttttattgatttcagactagcatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46837496 |
ttattgcaggtgattgatgagtatgatgaagaatccgaggttgcggaacgacttagaatcagggtatttatttctcttttattgatttcagactagcatg |
46837595 |
T |
|
| Q |
200 |
tatctgccatcagtatcttctacatgtttcttgtctcataatttgtctttacaagtttgatgattagtctcttagtatgatgcattcaattgatgcataa |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46837596 |
tatctgccatcagtatcttctacatgtttcttgtctcataacttgtctttacaagtttgatgattagtctcttagt---ttgcattcaattgatgcataa |
46837692 |
T |
|
| Q |
300 |
tcttg |
304 |
Q |
| |
|
||||| |
|
|
| T |
46837693 |
tcttg |
46837697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University