View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19416_low_18 (Length: 236)
Name: NF19416_low_18
Description: NF19416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19416_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 20024947 - 20024725
Alignment:
| Q |
1 |
cttcatttgaggcaactttggatcagtataggaagaagttgaaagagcttgagccttcagaaggttctgacaatgaaaactctaacgtggatggtgaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20024947 |
cttcatttgaggcaactttggatcagtataggaagaagttgaaagagcttgagccttcagaaggttctgacaatgaaaactctaacgtggatggtgaggt |
20024848 |
T |
 |
| Q |
101 |
agatgatttgaattttgaagctgttgagaaggagcggcaagagagtgtgactgatacattcatgtcacaggaagaagatgcaatccctatgcagaatggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20024847 |
agatgatttgaattttgaagctgttgagaaggagcggcaagagagtgtgactgatacattcatgtcacaggaagaagatgcaatccctatgcagaatggt |
20024748 |
T |
 |
| Q |
201 |
agtgatagtagtatgcctgatgt |
223 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
20024747 |
agtgatagtagtgtgcctgatgt |
20024725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University