View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19416_low_5 (Length: 467)
Name: NF19416_low_5
Description: NF19416
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19416_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 425 - 460
Target Start/End: Original strand, 30168411 - 30168446
Alignment:
| Q |
425 |
cccaattttggaagtcctacgtgtctttttcttctc |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
30168411 |
cccaattttggaagtcctacgtgtctttttcttctc |
30168446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 352 - 396
Target Start/End: Original strand, 43245384 - 43245428
Alignment:
| Q |
352 |
aaagggaaatgctgaaatttacaaatgaaacaagcaagaaatgca |
396 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
43245384 |
aaaggaaaatgctgaaatttacgaatgtaacaagcaagaaatgca |
43245428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University