View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_17 (Length: 385)
Name: NF19418_low_17
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 100 - 375
Target Start/End: Original strand, 24293250 - 24293526
Alignment:
| Q |
100 |
caatccatggtattgcattaaattcatcacttgatcatcattcattcggttgatatgtgtcgaggcactaattttctctacaaaacga-tataaaaattg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
24293250 |
caatccatggtattgcattaaattcatcacttgatcatcattcattcggttgatatgtgtcgaggcaccaattttctctacaaaacgaatataaaaattg |
24293349 |
T |
 |
| Q |
199 |
aatgtcaaacttgctcccttgttgaaatgtatgtatatgcattatatatattgaagtttacttcttaacttcaataatcgcacgttgaacattcaattgt |
298 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24293350 |
aatgtcaaacatgctcccttgttgaaatgtatgtatatgcattatatatgttgaagtttacttcttaacttcaataatcgcacattgaacattcaattgt |
24293449 |
T |
 |
| Q |
299 |
agatgttattgacgttaacactgacaccatgtcttctcctttcgtgctctttttatcctcaaattcttctccttcat |
375 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24293450 |
agatgttatcgacgttaacactgacaccatgtcttctcctttcgtgctctttttatcctcaaattcttctccttcat |
24293526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University