View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19418_low_21 (Length: 356)
Name: NF19418_low_21
Description: NF19418
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19418_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 346
Target Start/End: Original strand, 44259647 - 44259981
Alignment:
| Q |
19 |
gataaagccttgtttggctttgattgcttttcttttcatcgtaaatcttaagctcatttttatctgaaaatacatgttgtaggcttgtctgtagctagta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44259647 |
gataaagccttgtttggctttgattgcttttcttttcattgtaaatcttaagctcatttttatctgaaaatacatgttgtaggcttgtctgtagctagta |
44259746 |
T |
 |
| Q |
119 |
tacgaatcttgtaatgggaggaaacataaacagtcagtttca-----tgtgttgtgttggatacaccaggtgtaaataatatgtagattcccac--tttt |
211 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44259747 |
tacgaatcttgtaatgggaggtaacataaacagtcagtttcatgtgttgtgttgtgttggatacaccaggtgtaaataatatgtagattcccactatttt |
44259846 |
T |
 |
| Q |
212 |
gtgttgttttttctttctttcttggcttagatatttcatacaacgtccaaatatgattagtgggtgattttgtgtatggcttaaaattgaataatgtaaa |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44259847 |
gtgttgttttttctttctttcttggcttagatatttcatacaacgtccaaatatgattagtgagtgatttagtgtatggcttaaaattgaataatgtaaa |
44259946 |
T |
 |
| Q |
312 |
aatattgcatttttgtgcttttatcactgcctttg |
346 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| |
|
|
| T |
44259947 |
aatattgcatttttatgcttttatcacttcctttg |
44259981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University